Hereditary Breast and Gynecological Cancer Panel

Summary
Is a 28 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of an inherited susceptibility to breast and gynecological cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue. The genes on this panel are included in the Comprehensive Hereditary Cancer Panel.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
28
Test code
ON1801
Panel size
Medium
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Hereditary Breast and Gynecological Cancer Panel (test code ON1801):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

The most common hereditary cancer syndromes that are associated with an increased risk of breast and gynecological cancers are hereditary breast and ovarian cancer syndrome and Lynch syndrome, also known as hereditary nonpolyposis colon cancer (HNPCC). Carriers of pathogenic mutations in BRCA1 and BRCA2 have an increased risk of breast cancer and the lifetime risk of having a gynecologic cancers is 39-46% and 12-20%, respectively. Lynch syndrome is caused by inherited mutations in DNA mismatch repair genes, most often MSH2 and MLH1, but mutations also occur in MSH6, PMS2, and EPCAM. There is an increased incidence of several types of cancers in HNPCC. Most notably of the gynecological cancers, the endometrial cancer risk is 40-60%. Several other syndromes and genetic defects have been identified to increase the risk of breast and gynecological cancers. For example, Li-Fraumeni syndrome (TP53), Cowden syndrome (PTEN) and Peutz-Jeghers syndrome (STK11) increase the likelihood of having an inherited predisposition to breast and gynecological cancer. Mutations in DNA repair genes, RAD51C, RAD51D, and BRIP1, have shown clear evidence of an association with ovarian cancer. Certain, most often protein truncating variants in PALB2, CHEK2 and ATM have been shown to confer a moderate risk of breast cancer.

Genes in the Hereditary Breast and Gynecological Cancer Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
BARD1 Breast cancer AD 159 114
BLM Bloom syndrome AR 152 119
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
CDH1 CDH1-related cancer, Blepharocheilodontic syndrome 1 AD 178 242
CHEK2#* Li-Fraumeni syndrome AD/AR 275 197
DICER1* DICER1 syndrome AD 197 137
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
FANCM Fanconi anemia AR 6 50
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 56
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
NBN Breast cancer, Nijmegen breakage syndrome, demonstrating report layout issue with very long condition descriptions AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PMS2#* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
RAD50 Breast cancer, Nijmegen breakage syndrome-like disorder AD/AR 183 88
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RAD51D Ovarian cancer, familial AD 77 78
RECQL* Breast cancer AD 9 27
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
STK11 Peutz-Jeghers syndrome AD 173 460
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
XRCC2 Hereditary breast cancer AD/AR 10 21
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Hereditary Breast and Gynecological Cancer Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5

Test Strengths

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CHEK2 NM_001005735.2:3, PMS2 NM_000535.7:13-15. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.