Micromelic Dysplasia Panel

Summary
Is a 27 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of acromesomelic dysplasia, cranioectodermal dysplasia, Robinow syndrome or Weill-Marchesani syndrome. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
27
Test code
MA1901
Panel size
Medium
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Micromelic Dysplasia Panel (test code MA1901):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Acromesomelic dysplasia is an autosomal recessively inherited group of rare disorders characterized by severe dwarfism and limb abnormalities with normal facial appearance and intellect. Mutations in different genes cause three different types of acromesomelic dysplasia: Grebe, Hunter-Thomson and Maroteaux types. Robinow syndrome is characterized by limb shortening and abnormalities of the head, face and external genitalia. The clinical features are generally milder in the more common autosomal dominant form of Robinow syndrome than in the autosomal recessive form. In the presence of rib fusions, the recessive form of the syndrome should be considered. Cranioectodermal dysplasia is a rare developmental disorder characterized by congenital skeletal and ectodermal defects including dysmorphic features, nephronophthisis, hepatic fibrosis and ocular anomalies (mainly retinitis pigmentosa). Cranioectodermal dysplasia is a heterogenous disease belonging to the ciliopathies and is caused by mutations in the IFT122, IFT43, WDR19 and WDR35 genes. In most cases, the mode of inheritance is autosomal recessive. Weill-Marchesani syndrome is a rare condition characterized by short stature, brachydactyly, joint stiffness, and characteristic eye abnormalities including microspherophakia, ectopia of the lens, severe myopia, and glaucoma. Both autosomal recessive and autosomal dominant forms exist. Achondroplasia is characterized by rhizomelia, exaggerated lumbar lordosis, brachydactyly, and macrocephaly with frontal bossing and midface hypoplasia. The estimated incidence is at about 1/25,000 live births worldwide. Achondroplasia is due to mutations in the FGFR3 gene. Inheritance is autosomal dominant so genetic counseling is warranted. Achondroplasia has overlapping features with conditions such as multiple epiphyseal dysplasia tarda, achondrogenesis, osteopetrosis, and thanatophoric dysplasia.

Genes in the Micromelic Dysplasia Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTSL2#* Geleophysic dysplasia 3 AR 8 28
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) AD/AR 12 23
DVL1 Robinow syndrome AD 17 19
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 AD 1465 2679
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN AD/AR 54 77
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia AD/AR 23 53
GNAS McCune-Albright syndrome, Progressive osseous heteroplasia, Pseudohypoparathyroidism, Albright hereditary osteodystrophy AD 64 274
IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2 AR 13 23
IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 38 63
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32
INPPL1 Opsismodysplasia AR 16 32
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital AR 21 27
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities AD/AR 32 75
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
SHOX#* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short stature XL/PAR 25 431
SLC35D1 Schneckenbecken dysplasia AR 7 7
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) AD 47 144
TRIP11* Achondrogenesis, type IA AR 11 17
TRPS1 Trichorhinophalangeal syndrome type 1, Trichorhinophalangeal syndrome type 3 AD 66 140
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 AR 28 31
WNT5A Robinow syndrome AD 7 11
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Micromelic Dysplasia Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GNAS Chr20:57478716 c.2242-11A>G NM_080425.2
IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3
SHOX ChrX:591568 c.-65C>A NM_000451.3
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 NM_014694.4:10-19, SHOX NM_006883.2:6. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.