Comprehensive Cancer Screen
Is an 83 gene test for healthy adults who want information about their genetic risk of developing cancer that can be monitored or even prevented before symptoms appear.
- PLUS
Summary
The Blueprint Genetics Comprehensive Cancer Screen (test code PS0003):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
The Comprehensive Cancer Screen test is for healthy adults interested in learning about their genetic risk of developing cancer so they can have monitoring or preventative measures before symptoms appear. After receiving a positive result, healthcare provider can help their patient to make informed decisions about lifestyle choices or taking a preventive action.
These tests are for personal risk assessment of healthy individuals. Individuals with a family history of a hereditary disorder should have testing with the appropriate diagnostic panel instead of a Proactive Screen test.
The Comprehensive Cancer Screen test includes screening for
-All cancer-related genes in ACMG 3.1 SF list (PMID: 35802134)
-Genes related to low and moderate-to-high risk of cancer
-Please note that the definitions of low and moderate-to-high risk genes is not straightforward. Some genes associate with a risk of developing benign tumors that may transform to malignant, but this rate may be poorly defined or conflicting
-A gene is classified as a moderate-to-high risk cancer gene when the risk ratio (odds ratio) of the disease associated variants in the gene exceeds 3.0 for any cancer at (PMID https://pubmed.ncbi.nlm.nih.gov/31406321/). However, this limit is not absolute since variable numbers are presented for many genes
Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Genes in the Comprehensive Cancer Screen and their clinical significance
To view complete table content, scroll horizontally.
| Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
|---|---|---|---|---|
| AIP | Pituitary adenoma, familial isolated | AD | 53 | 110 |
| ANKRD26 | Thrombocytopenia | AD | 6 | 21 |
| APC | Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis | AD | 773 | 1926 |
| ATM | Breast cancer, Ataxia-Telangiectasia | AD/AR | 1047 | 1109 |
| AXIN2 | Oligodontia-colorectal cancer syndrome, Oligondontia, isolated | AD | 19 | 18 |
| BAP1 | Tumor predisposition syndrome | AD | 74 | 113 |
| BARD1 | Breast cancer | AD | 159 | 114 |
| BMPR1A* | Polyposis, juvenile intestinal | AD | 110 | 140 |
| BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial | AD | 2997 | 2631 |
| BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
| BRIP1 | Fanconi anemia, Breast cancer | AD/AR | 238 | 189 |
| CDC73 | Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome | AD | 50 | 101 |
| CDH1 | CDH1-related cancer, Blepharocheilodontic syndrome 1 | AD | 178 | 242 |
| CDK4 | Melanoma, cutaneous malignant | AD | 4 | 14 |
| CDKN1B | Multiple endocrine neoplasia | AD | 13 | 20 |
| CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
| CEBPA | Acute myeloid leukemia, familial | AD | 15 | 13 |
| CHEK2#* | Li-Fraumeni syndrome | AD/AR | 275 | 197 |
| CTNNA1 | Macular dystrophy, patterned 2 | AD | 6 | 10 |
| CYLD | Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis | AD | 34 | 106 |
| DDX41 | Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to | AD | 9 | 21 |
| DICER1* | DICER1 syndrome | AD | 197 | 137 |
| EGFR | Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial | AD/AR | 55 | 18 |
| EPCAM | Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis | AD/AR | 38 | 80 |
| ERCC6L2 | Bone marrow failure syndrome 2 | AR | 4 | 9 |
| ETV6 | Thrombocytopenia 5 | AD | 10 | 38 |
| EXT1 | Multiple cartilagenious exostoses 1 | AD | 97 | 523 |
| EXT2 | Multiple cartilagenious exostoses 2 | AD | 45 | 250 |
| FH | Hereditary leiomyomatosis and renal cell cancer | AD/AR | 178 | 207 |
| FLCN | Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous | AD | 154 | 210 |
| GATA2 | Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency | AD | 30 | 142 |
| GREM1 | Hereditary mixed polyposis syndrome | AD/AR | 1 | 8 |
| HOXB13 | Familial prostate cancer | AD/AR | 1 | 5 |
| KIT | Gastrointestinal stromal tumor, Piebaldism | AD | 79 | 116 |
| LZTR1 | Schwannomatosis, Noonan syndrome | AD/AR | 34 | 71 |
| MAX | Pheochromocytoma | AD | 13 | 31 |
| MEN1 | Hyperparathyroidism, familial primary, Multiple endocrine neoplasia | AD | 263 | 730 |
| MET | Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to | AD/AR | 20 | 34 |
| MLH1 | Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 873 | 1191 |
| MSH2 | Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome | AD/AR | 933 | 1249 |
| MSH6 | Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 672 | 586 |
| MUTYH | Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas | AR | 134 | 168 |
| NBN | Breast cancer, Nijmegen breakage syndrome, demonstrating report layout issue with very long condition descriptions | AD/AR | 188 | 97 |
| NF1* | Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome | AD | 1157 | 2901 |
| NF2 | Schwannomatosis, Neurofibromatosis | AD | 66 | 433 |
| NTHL1 | Familial adenomatous polyposis 3 | AR | 7 | 3 |
| PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
| PDGFRA# | Gastrointestinal stromal tumor | AD | 22 | 19 |
| PHOX2B | Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease | AD | 11 | 86 |
| PMS2#* | Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 319 | 342 |
| POLD1 | Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency | AD/AR | 3 | 31 |
| POLE | Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) | AD/AR | 8 | 70 |
| POT1 | Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 | AD | 2 | 34 |
| PRKAR1A | Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex | AD | 75 | 183 |
| PTCH1 | Basal cell nevus syndrome | AD | 193 | 522 |
| PTEN* | Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome | AD | 435 | 638 |
| RAD50 | Breast cancer, Nijmegen breakage syndrome-like disorder | AD/AR | 183 | 88 |
| RAD51C | Fanconi anemia, Breast-ovarian cancer, familial | AD/AR | 107 | 125 |
| RAD51D | Ovarian cancer, familial | AD | 77 | 78 |
| RB1 | Retinoblastoma | AD | 266 | 1102 |
| RECQL* | Breast cancer | AD | 9 | 27 |
| RET | Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia | AD/AR | 122 | 407 |
| RHBDF2 | Tylosis with esophageal cancer | AD | 2 | 4 |
| RUNX1 | Platelet disorder, familial, with associated myeloid malignancy | AD | 47 | 101 |
| SDHA* | Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG | AD/AR | 54 | 87 |
| SDHAF2 | Paragangliomas | AD | 4 | 5 |
| SDHB | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome | AD | 151 | 272 |
| SDHC | Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas | AD | 29 | 60 |
| SDHD# | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency | AD | 68 | 170 |
| SMAD4 | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia | AD | 179 | 143 |
| SMARCA4 | Rhabdoid tumor predisposition syndrome | AD | 76 | 57 |
| SMARCB1 | Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 | AD | 36 | 118 |
| STK11 | Peutz-Jeghers syndrome | AD | 173 | 460 |
| SUFU | Medulloblastoma, Basal cell nevus syndrome | AD | 22 | 44 |
| TERC | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD | 42 | 73 |
| TERT | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD/AR | 48 | 156 |
| TINF2 | Revesz syndrome, Dyskeratosis congenita | AD | 25 | 42 |
| TMEM127 | Pheochromocytoma | AD | 30 | 52 |
| TP53 | Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma | AD | 393 | 505 |
| TSC1 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 177 | 372 |
| TSC2 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 396 | 1195 |
| VHL | Erythrocytosis, familial, Pheochromocytoma | AD/AR | 206 | 614 |
| WT1 | Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 | AD | 42 | 183 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Comprehensive Cancer Screen
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| AIP | Chr11:67250360 | NM_003977.2 | rs267606588 | |
| AIP | Chr11:67250410 | c.-220G>A | NM_003977.2 | rs267606540 |
| ANKRD26 | Chr10:27389371 | c.-116C>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389373 | c.-118C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A/G | NM_014915.2 | |
| ANKRD26 | Chr10:27389376 | c.-121A>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389380 | c.-127_-126delAT | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389389 | c.-134G>A | NM_014915.2 | rs863223318 |
| APC | Chr5:112043009-112043595 | |||
| APC | Chr5:112043220 | c.-195A>C | NM_001127511.2 | |
| APC | Chr5:112043223 | c.-192A>T | NM_001127511.2 | |
| APC | Chr5:112043223 | c.-192A>G/T | NM_001127511.2 | |
| APC | Chr5:112043223 | c.-192A>G | NM_001127511.2 | rs879253784 |
| APC | Chr5:112043224 | c.-191T>C | NM_001127511.2 | |
| APC | Chr5:112043225 | c.-190G>A | NM_001127511.2 | |
| APC | Chr5:112043289 | c.-125delA | NM_001127511.2 | |
| APC | Chr5:112072710-112073585 | |||
| APC | Chr5:112111314 | c.423-12A>G | NM_000038.5 | |
| APC | Chr5:112111315 | c.423-11A>G | NM_000038.5 | |
| APC | Chr5:112115546 | c.532-941G>A | NM_000038.5 | rs730881227 |
| APC | Chr5:112151175 | c.835-17A>G | NM_000038.5 | |
| APC | Chr5:112158419 | c.1408+731C>T | NM_000038.5 | |
| APC | Chr5:112158423 | c.1408+735A>T | NM_000038.5 | |
| ATM | Chr11:108093770 | c.-174A>G | NM_000051.3 | |
| ATM | Chr11:108094508 | c.-31+595G>A | NM_000051.3 | |
| ATM | Chr11:108098321 | c.-30-1G>T | NM_000051.3 | rs869312754 |
| ATM | Chr11:108138753 | c.2639-384A>G | NM_000051.3 | |
| ATM | Chr11:108141209 | c.2839-579_2839-576delAAGT | NM_000051.3 | |
| ATM | Chr11:108151710 | c.3403-12T>A | NM_000051.3 | rs201370733 |
| ATM | Chr11:108158168 | c.3994-159A>G | NM_000051.3 | rs864622543 |
| ATM | Chr11:108164028 | c.4612-12A>G | NM_000051.3 | |
| ATM | Chr11:108179837 | c.5763-1050A>G | NM_000051.3 | rs774925473 |
| ATM | Chr11:108214779 | c.8418+681A>G | NM_000051.3 | rs748635985 |
| BAP1 | Chr3:52435659 | c.*644delG | NM_004656.3 | |
| BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
| BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
| BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
| BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
| BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
| BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
| BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
| BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
| BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
| BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
| BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
| BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
| BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
| BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
| BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
| BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
| BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
| BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
| BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
| BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
| BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
| BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
| BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
| BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
| BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
| BRIP1 | Chr17:59858864 | c.1629-498A>T | NM_032043.2 | |
| CDH1 | Chr16:68842843 | c.687+92T>A | NM_004360.3 | |
| CDKN1B | Chr12:12870317 | c.-454_-451delTTCC | NM_004064.3 | rs786201010 |
| CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
| CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
| CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
| CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
| CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
| CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
| CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
| CYLD | Chr16:50813428 | c.1139-148A>G | NM_015247.2 | |
| DICER1 | Chr14:95559038 | c.5364+1187T>G | NM_177438.2 | |
| EPCAM | Chr2:47606078 | c.556-14A>G | NM_002354.2 | rs376155665 |
| GATA2 | Chr3:128202131 | c.1017+572C>T | NM_032638.4 | |
| GATA2 | Chr3:128202162 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | NM_032638.4 | |
| GATA2 | Chr3:128202171 | c.1017+532T>A | NM_032638.4 | |
| LZTR1 | Chr22:21336623 | c.-38T>A | NM_006767.3 | |
| LZTR1 | Chr22:21350968 | c.2220-17C>A | NM_006767.3 | rs1249726034 |
| MEN1 | Chr11:64571394 | c.*412G>A | NM_000244.3 | |
| MEN1 | Chr11:64575165 | c.670-15_670-14delTC | NM_000244.3 | |
| MEN1 | Chr11:64577602 | c.-23-11_-22delTTGCCTTGCAGGC | NM_000244.3 | |
| MEN1 | Chr11:64577603 | c.-23_-22insT | NM_000244.3 | |
| MEN1 | Chr11:64577626 | c.-23-22C>A | NM_000244.3 | |
| MLH1 | Chr3:37034619 | c.-413_-411delGAG | NM_000249.3 | rs953169437 |
| MLH1 | Chr3:37034932 | c.-107C>G | NM_000249.3 | rs587778886 |
| MLH1 | Chr3:37034976 | c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA | NM_000249.3 | |
| MLH1 | Chr3:37034997 | c.-42C>T | NM_000249.3 | rs41285097 |
| MLH1 | Chr3:37035012 | c.-27C>A | NM_000249.3 | rs587779001 |
| MLH1 | Chr3:37035260 | c.116+106G>A | NM_000249.3 | |
| MLH1 | Chr3:37038099 | c.117-11T>A | NM_000249.3 | rs267607711 |
| MLH1 | Chr3:37050292 | c.454-13A>G | NM_000249.3 | rs267607749 |
| MLH1 | Chr3:37061788 | c.885-9_887dupTCCTGACAGTTT | NM_000249.3 | rs63751620 |
| MLH1 | Chr3:37070436 | c.1558+13T>A | NM_000249.3 | rs267607834 |
| MSH2 | Chr2:47630106 | c.-225G>C | NM_000251.2 | rs138068023 |
| MSH2 | Chr2:47630150 | c.-181G>A | NM_000251.2 | rs786201698 |
| MSH2 | Chr2:47630249 | c.-81dupA | NM_000251.2 | rs560991330,rs587779187 |
| MSH2 | Chr2:47630251 | c.-78_-77delTG | NM_000251.2 | rs587779182 |
| MSH2 | Chr2:47698086 | c.1662-17dupG | NM_000251.2 | rs587779099 |
| MSH6 | Chr2:48018295 | c.457+33_457+34insGTGT | NM_000179.2 | |
| MSH6 | Chr2:48030536 | c.3173-16_3173-5delCCCTCTCTTTTA | NM_000179.2 | |
| MSH6 | Chr2:48034014 | c.*15A>C | NM_000179.2 | |
| MSH6 | Chr2:48034047 | c.*49_*68dupTTCAGACAACATTATGATCT | NM_000179.2 | rs777409019 |
| MUTYH | Chr1:45797534 | c.998-13T>G | NM_001128425.1 | |
| MUTYH | Chr1:45798558 | c.504+19_504+31delTAGGGGAAATAGG | NM_001128425.1 | rs781222233 |
| NF1 | Chr17:29422055 | c.-273A>C | NM_001042492.2 | |
| NF1 | Chr17:29422056 | c.-272G>A | NM_001042492.2 | |
| NF1 | Chr17:29431417 | c.60+9031_60+9035delAAGTT | NM_001042492.2 | |
| NF1 | Chr17:29475515 | c.61-7486G>T | NM_001042492.2 | |
| NF1 | Chr17:29488136 | c.288+2025T>G | NM_001042492.2 | |
| NF1 | Chr17:29508426 | c.587-14T>A | NM_001042492.2 | |
| NF1 | Chr17:29508428 | c.587-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29510334 | c.888+651T>A | NM_001042492.2 | |
| NF1 | Chr17:29510427 | c.888+744A>G | NM_001042492.2 | |
| NF1 | Chr17:29510472 | c.888+789A>G | NM_001042492.2 | |
| NF1 | Chr17:29527428 | c.889-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29530107 | c.1260+1604A>G | NM_001042492.2 | |
| NF1 | Chr17:29533239 | c.1261-19G>A | NM_001042492.2 | |
| NF1 | Chr17:29534143 | c.1392+754T>G | NM_001042492.2 | |
| NF1 | Chr17:29540877 | c.1393-592A>G | NM_001042492.2 | |
| NF1 | Chr17:29542762 | c.1527+1159C>T | NM_001042492.2 | |
| NF1 | Chr17:29548419 | c.1642-449A>G | NM_001042492.2 | rs863224655 |
| NF1 | Chr17:29549489 | c.*481A>G | NM_001128147.2 | |
| NF1 | Chr17:29553439 | c.2002-14C>G | NM_001042492.2 | |
| NF1 | Chr17:29554225 | c.2252-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29556025 | c.2410-18C>G | NM_001042492.2 | |
| NF1 | Chr17:29556027 | c.2410-16A>G | NM_001042492.2 | |
| NF1 | Chr17:29556028 | c.2410-15A>G | NM_001042492.2 | |
| NF1 | Chr17:29556031 | c.2410-12T>G | NM_001042492.2 | |
| NF1 | Chr17:29556839 | c.2851-14_2851-13insA | NM_001042492.2 | |
| NF1 | Chr17:29557267 | c.2991-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29563299 | c.3974+260T>G | NM_001042492.2 | |
| NF1 | Chr17:29577082 | c.4110+945A>G | NM_001042492.2 | |
| NF1 | Chr17:29580296 | c.4173+278A>G | NM_001042492.2 | |
| NF1 | Chr17:29588708 | c.4578-20_4578-18delAAG | NM_001042492.2 | |
| NF1 | Chr17:29588715 | c.4578-14T>G | NM_001042492.2 | |
| NF1 | Chr17:29654479 | c.5269-38A>G | NM_001042492.2 | |
| NF1 | Chr17:29656858 | c.5610-456G>T | NM_001042492.2 | |
| NF1 | Chr17:29657848 | c.5812+332A>G | NM_001042492.2 | rs863224491 |
| NF1 | Chr17:29661577 | c.5813-279A>G | NM_001042492.2 | |
| NF1 | Chr17:29664375 | c.6428-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29664618 | c.6642+18A>G | NM_001042492.2 | |
| NF1 | Chr17:29676126 | c.7190-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29676127 | c.7190-11_7190-10insGTTT | NM_001042492.2 | |
| NF1 | Chr17:29685177 | c.7971-321C>G | NM_001042492.2 | |
| NF1 | Chr17:29685481 | c.7971-17C>G | NM_001042492.2 | |
| NF1 | Chr17:29685665 | c.8113+25A>T | NM_001042492.2 | |
| NF2 | Chr22:30050946 | c.516+232G>A | NM_000268.3 | |
| PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
| PDGFRA | Chr4:55161473 | c.*34G>A | NM_006206.4 | rs552950826 |
| PMS2 | Chr7:6027263 | c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC | NM_000535.5 | rs751973268 |
| PMS2 | Chr7:6048599 | c.23+21_23+28delTCCGGTGT | NM_000535.5 | |
| POLE | Chr12:133249181 | c.1686+32C>G | NM_006231.2 | rs762985435 |
| PRKAR1A | Chr17:66508599 | c.-97G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66508689 | c.-7G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66508690 | c.-7+1G>A | NM_002734.4 | |
| PRKAR1A | Chr17:66521878 | c.550-17T>A | NM_002734.4 | |
| PRKAR1A | Chr17:66523964 | c.709-7_709-2delTTTTTA | NM_002734.4 | rs281864801 |
| PTCH1 | Chr9:98226337 | c.2561-2057A>G | NM_000264.3 | |
| PTEN | Chr10:89622883-89623482 | |||
| PTEN | Chr10:89622988 | c.-1239A>G | NM_000314.6 | |
| PTEN | Chr10:89623049 | c.-1178C>T | NM_000314.6 | |
| PTEN | Chr10:89623056 | c.-1171C>T | NM_000314.6 | rs587779981 |
| PTEN | Chr10:89623116 | c.-1111A>G | NM_000314.6 | |
| PTEN | Chr10:89623226 | c.-1001T>C | NM_000314.4 | |
| PTEN | Chr10:89623296 | c.-931G>A | NM_000314.4 | rs587781959 |
| PTEN | Chr10:89623306 | c.-921G>T | NM_000314.4 | |
| PTEN | Chr10:89623331 | c.-896T>C | NM_000314.4 | |
| PTEN | Chr10:89623365 | c.-862G>T | NM_000314.4 | rs587776675 |
| PTEN | Chr10:89623373 | c.-854C>G | NM_000314.4 | |
| PTEN | Chr10:89623392 | c.-835C>T | NM_000314.4 | rs587779994 |
| PTEN | Chr10:89623428 | c.-799G>C | NM_000314.4 | rs587779992 |
| PTEN | Chr10:89623462 | c.-765G>A | NM_000314.4 | |
| PTEN | Chr10:89690791 | c.210-8dupT | NM_000314.4 | |
| PTEN | Chr10:89692749 | c.254-21G>C | NM_000314.4 | |
| PTEN | Chr10:89725294 | c.*65T>A | NM_000314.4 | |
| PTEN | Chr10:89725304 | c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG | NM_000314.4 | |
| RB1 | Chr13:48877814 | NM_000321.2 | rs576931877 | |
| RB1 | Chr13:48877836 | NM_000321.2 | ||
| RB1 | Chr13:48877837 | c.-212G>A | NM_000321.2 | |
| RB1 | Chr13:48877851 | c.-198G>A | NM_000321.2 | rs387906521 |
| RB1 | Chr13:48877851 | c.-198G>T | NM_000321.2 | |
| RB1 | Chr13:48877852 | c.-197G>A | NM_000321.2 | |
| RB1 | Chr13:48877853 | NM_000321.2 | ||
| RB1 | Chr13:48877856 | NM_000321.2 | ||
| RB1 | Chr13:48877856 | NM_000321.2 | ||
| RB1 | Chr13:48877856 | c.-193T>A/G | NM_000321.2 | |
| RB1 | Chr13:48877857 | c.-192G>A | NM_000321.2 | |
| RB1 | Chr13:48877860 | c.-189G>T | NM_000321.2 | rs387906520 |
| RB1 | Chr13:48877899 | c.-150G>C | NM_000321.2 | |
| RB1 | Chr13:48877900 | c.-149G>T | NM_000321.2 | |
| RB1 | Chr13:48921946 | c.501-15T>G | NM_000321.2 | |
| RB1 | Chr13:48930735 | c.608-3418A>G | NM_000321.2 | |
| RB1 | Chr13:48937921 | c.861+828T>G | NM_000321.2 | |
| RB1 | Chr13:48947691 | c.1215+63T>G | NM_000321.2 | |
| RB1 | Chr13:48954175 | c.1390-14A>G | NM_000321.2 | rs9535023 |
| RB1 | Chr13:48954239 | c.1421+20_1421+33delTAAAAAATTTTTTT | NM_000321.2 | |
| RB1 | Chr13:49027115 | c.1696-14C>T | NM_000321.2 | rs776912915 |
| RB1 | Chr13:49027117 | c.1696-12T>G | NM_000321.2 | |
| RB1 | Chr13:49030329 | c.1815-11A>G | NM_000321.2 | |
| RB1 | Chr13:49039121 | c.2212-13T>A | NM_000321.2 | |
| RB1 | Chr13:49039327 | c.2326-14T>C | NM_000321.2 | |
| RB1 | Chr13:49046098 | c.2490-1398A>G | NM_000321.2 | |
| RB1 | Chr13:49047468 | c.2490-28T>C | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>C | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>T | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>G | NM_000321.2 | |
| RB1 | Chr13:49047470 | c.2490-26A>C/G/T | NM_000321.2 | |
| RET | Chr10:43572670 | c.-37G>C | NM_020975.4 | rs751005619 |
| RET | Chr10:43572680 | c.-27C>G | NM_020975.4 | |
| RET | Chr10:43582162 | c.73+9385_73+9395delAGCAACTGCCA | NM_020975.4 | rs368137511 |
| RET | Chr10:43606948 | c.1522+35C>T | NM_020975.4 | rs377130948 |
| RET | Chr10:43612192 | c.2284+13C>T | NM_020975.4 | |
| RET | Chr10:43612198 | c.2284+19C>T | NM_020975.4 | |
| RET | Chr10:43613947 | c.2392+19T>C | NM_020975.4 | rs778745375 |
| SMARCB1 | Chr22:24130008 | c.93+559A>G | NM_003073.3 | |
| SMARCB1 | Chr22:24176316 | c.1119-12C>G | NM_003073.3 | |
| SMARCB1 | Chr22:24176437 | c.*70C>T | NM_003073.3 | |
| SMARCB1 | Chr22:24176449 | c.*82C>T | NM_003073.3 | |
| STK11 | Chr19:1220520 | c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG | NM_000455.4 | |
| STK11 | Chr19:1220530 | c.598-32_597+31delGCCCCCTCCCGGGC | NM_000455.4 | |
| TERC | Chr3:169482870 | n.-22C>T | NR_001566.1 | |
| TERC | Chr3:169482906 | NR_001566.1 | ||
| TERC | Chr3:169482948 | n.-100C>G | NR_001566.1 | rs199422256 |
| TERC | Chr3:169483086 | NR_001566.1 | rs199422255 | |
| TERT | Chr5:1271334 | c.2383-15C>T | NM_198253.2 | rs574645600 |
| TERT | Chr5:1295161 | c.-57A>C | NM_198253.2 | |
| TMEM127 | Chr2:96931137 | c.-18C>T | NM_017849.3 | rs121908813 |
| TP53 | Chr17:7571520 | NM_000546.5 | ||
| TP53 | Chr17:7577647 | c.673-39G>A | NM_000546.5 | |
| TP53 | Chr17:7579601 | c.97-11C>G | NM_000546.5 | |
| TP53 | Chr17:7590694 | c.-29+1G>T | NM_000546.5 | |
| TSC1 | Chr9:135800306 | c.363+668G>A | NM_000368.4 | |
| TSC2 | Chr16:2106052 | c.600-145C>T | NM_000548.3 | |
| TSC2 | Chr16:2107460 | c.848+281C>T | NM_000548.3 | rs45517132 |
| TSC2 | Chr16:2110656 | c.976-15G>A | NM_000548.3 | rs45517150 |
| TSC2 | Chr16:2127477 | c.2838-122G>A | NM_000548.3 | |
| TSC2 | Chr16:2138031 | c.5069-18A>G | NM_000548.3 | rs45484794 |
| VHL | Chr3:10183453 | c.-75_-55delCGCACGCAGCTCCGCCCCGCG | NM_000551.3 | rs727503744 |
| VHL | Chr3:10183471 | c.-54_-44dupTCCGACCCGCG | NM_000551.3 | |
| VHL | Chr3:10191719 | c.*70C>A | NM_000551.3 | |
| VHL | Chr3:10191719 | c.*70C>T | NM_000551.3 | rs552290225 |
Test Strengths
The strengths of this test include:
- CAP-accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
- Our publicly available analytic validation demonstrates complete details of test performance
- ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CHEK2 NM_001005735.2:3, PDGFRA NM_001347828.2:2, PMS2 NM_000535.7:13-15, SDHD NM_001276506.2:4. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.
| Sensitivity % (TP/(TP+FN) | Specificity % | |||
|---|---|---|---|---|
| GIAB Version 3.3.2 | GIAB Version 4.2.1 | GIAB Version 3.3.2 | GIAB Version 4.2.1 | |
| Single nucleotide variants | 99.57 % | 97.58 % | 100 % | 100 % |
| Insertions, deletions | ||||
| 1-10 bps | 95.38 % | 95.13 % | 100.00 % | 100.00 % |
| 11-20 bps | 99.09 % | 98.15 % | 100.00 % | 100.00 % |
| 21-50 bps | 98.78 % | 98.85 % | 100.00 % | 100.00 % |
| 2-50 bps | 97.62 % | 97.41 % | 100.00 % | 100.00 % |
| Copy number variants (exon level dels/dups, clinical sample performance) | Sensitivity | Specificity | ||
| 1 exon level deletion (heterozygous) | 100% (14/14) | NA | ||
| 1 exon deletion (homozygous or hemizygous) | 100% (5/5) | NA | ||
| 2-4 exon deletion (heterozygous or homozygous) | 100% (17/17) | NA | ||
| 5-33 exon deletion (heterozygous) | 100% (12/12) | NA | ||
| 1-5 exon duplication (heterozygous or homozygous) | 77% (10/13) | NA | ||
| 9-31 exon duplication (heterozygous) | 100% (7/7) | NA | ||
| Simulated CNV detection in reference samples (n=10) | Sensitivity | |||
| 5 exon level deletion/duplication | 98 % | |||
| Microdeletion/-duplication syndromes (large CNVs, n=22)) | ||||
| Size range (0.1-47 Mb) | 100% (22/22) | |||
| The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||||
| Average of median sequencing depths in reference samples | 136x | |||
| Nucleotides with >20x sequencing coverage (%) | 99.77% | |||
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
| ANALYTIC VALIDATION (reference samples; n=4) | Sensitivity % | |||
| Single nucleotide variants | ||||
| Heteroplasmic (45-100%) | 100.0% (50/50) | |||
| Heteroplasmic (35-45%) | 100.0% (87/87) | |||
| Heteroplasmic (25-35%) | 100.0% (73/73) | |||
| Heteroplasmic (15-25%) | 100.0% (74/74) | |||
| Heteroplasmic (5-15%) | 100.0% (79/79) | |||
| Heteroplasmic (<5%) | 53.3 % (8/15) | |||
| CLINICAL VALIDATION (n=20 samples) | ||||
| Single nucleotide variants (n=18 SNVs) | 100.0% (3/3) | |||
| Heteroplasmic (10-15%) | 100.0% (5/5) | |||
| Heteroplasmic (5-10%) | 100.0% (5/5) | |||
| Heteroplasmic (<5%) | 20% (1/5) | |||
| Insertions and deletions by sequence analysis (n=3) | ||||
| Heteroplasmic (45-100%) 1-10bp | 100.0% (3/3) | |||
| Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations) | ||||
| Insertions and deletions 1-24 bps by sequence analysis; n=17 | ||||
| Homoplasmic (100%) 1-24bp | 100.0% (17/17) | |||
| Heteroplasmic (50%) | 100.0% (17/17) | |||
| Heteroplasmic (25%) | 100.0% (17/17) | |||
| Heteroplasmic (20%) | 100.0% (17/17) | |||
| Heteroplasmic (15%) | 100.0% (17/17) | |||
| Heteroplasmic (10%) | 94.1% (16/17) | |||
| Heteroplasmic (5%) | 94.1% (16/17) | |||
| Copy number variants (separate artifical mutations; n=1500) | ||||
| Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | |||
| Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | |||
| Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238) | ||||
| Mean of medians | ||||
| Mean sequencing depth MQ0 | 6334x | |||
| Nucleotides with >1000x MQ0 sequencing coverage (%) | 100% | |||
| rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation | 12X | |||
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.
Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported.
Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.
Other
- ACMG SF v3.1 list for reporting of secondary findings in clinical exome and genome sequencing: A policy statement of the American College of Medical Genetics and Genomics (ACMG)
- Physician-directed genetic screening to evaluate personal risk for medically actionable disorders: a large multi-center cohort study
- American Cancer Society
- Canadian Cancer Society
- GeneReviews - BRCA1 and BRCA2 Hereditary Breast and Ovarian Cancer
- GeneReviews - BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer
- Fighting Hereditary Breast and Ovarian Cancer
- GeneReviews - Lynch Syndrome